IthaID: 3687



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Variant of Uncertain Significance
Common Name: IVS II-806 (G>C) HGVS Name: HBB:c.316-45G>C
Hb Name: N/A Protein Info: N/A
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
TAAGGCTGGATTATTCTGAGTCCAAGCTAG [G/C] CCCTTTTGCTAATCATGTTCATACCTCTTAT (Strand: -)

Comments: Found in twenty Malay and Chinese individuals presented with slightly to moderate decreased levels of MCV and MCH, in the first report.

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:N/A
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 71845
Size: 1 bp
Located at: β
Specific Location: Intron 2

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Chinese, Malay
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Luo S, Chen X, Zeng D, Tang N, Yuan D, Zhong Q, Mao A, Xu R, Yan T, The value of single-molecule real-time technology in the diagnosis of rare thalassemia variants and analysis of phenotype-genotype correlation., J Hum Genet, 67(4), 183-195, 2022 PubMed

Microattributions

A/AContributor(s)DateComments
1Li, Youqiong2021-03-09Report of an update.
Created on 2020-10-27 14:16:16, Last reviewed on 2023-02-21 14:54:29 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.