IthaID: 3721
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | CD 14 CTG>-TG | HGVS Name: | HBB:c.43delC |
| Hb Name: | N/A | Protein Info: | N/A |
| Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
AGGAGAAGTCTGCCGTTACTGCC [T/-] AGGAGAAGTCTGCCGTTACTGCC (Strand: -)
Protein sequence:
MVHLTPEEKSAVTACGARX
Comments: Found in two in a 1-year old girl with significantly reduced MCV 63.4 fL and MCH 18.2 pg. The mutation was inherited from her 27-year old father, who was also associated with significantly reduced MCV 63.4 fL, MCH 18.2 pg and Hb 11.5 g/dL. The T deletion, causing a frameshift that introduces a premature stop codon four amino acids further down the new reading frame.
External Links
No available links
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia |
| Allele Phenotype: | N/A |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 70637 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | Exon 1 |
Other details
| Type of Mutation: | Point-Mutation(Deletion) |
|---|---|
| Effect on Gene/Protein Function: | Frameshift (Translation) |
| Ethnic Origin: | Chinese |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Zhang H, Li C, Li J, Hou S, Chen D, Yan H, Chen S, Liu S, Yin Z, Yang X, Tan J, Huang X, Zhang L, Fang J, Zhang C, Li W, Guo J, Lei D, Next-generation sequencing improves molecular epidemiological characterization of thalassemia in Chenzhou Region, P.R. China., J Clin Lab Anal, 33(4), e22845, 2019 PubMed
Created on 2021-01-30 14:57:41,
Last reviewed on 2021-02-01 12:30:52 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.