IthaID: 3933



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: 3'UTR +116 (+A) HGVS Name: HBB:c.*116dup
Hb Name: N/A Protein Info: N/A
Also known as: β nt + 1590 (+A)

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
GAGCATCTGGATTCTGCCTAATAAAAAA [-/A] CATTTATTTTCATTGCAATGATGTATTTA (Strand: -)

Comments: Detected together with c.79G>A (HbE) during thalassaemia screening in one person with microcytic hypochromic anemia. It was reported as HBB:c.*116_*117insA.

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:N/A
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 72134
Size: 1 bp
Located at: β
Specific Location: 3'UTR

Other details

Type of Mutation: Point-Mutation(Insertion)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Vietnamese
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Frequencies

Publications / Origin

  1. Xinh PT, Chuong HQ, Ha NTT, Tram HDB, Van Dong C, Thanh LVH, Hoa NTH, Nghia H, Binh NT, Dung PC, Vu HA, Spectrum of HBB gene mutations among 696 β-thalassemia patients and carriers in Southern Vietnam., Mol Biol Rep, 49(4), 2601-2606, 2022 PubMed
Created on 2022-05-12 16:00:22, Last reviewed on 2022-05-13 12:21:16 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.