IthaID: 398



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 109 (-C) HGVS Name: HBA1:c.328delC
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
CTAAGCCACTGCCTGCTGGTGACC [C/-] TGGCCGCCCACCTCCCCGCCGAGT (Strand: +)

Also known as:

Comments: Reported in literature as CD 108 (-C), which does not follow the HGVS Sequence Variant Nomenclature recommendations. An update report, found in compound heterozygosity with --MED I (IthaID: 312), leading to Hb H disease.

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: α-thalassaemia
Allele Phenotype:α+/α0
Associated Phenotypes: Haemolytic anaemia [HP:0001878]

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 34362
Size: 1 bp
Located at: α1
Specific Location: Exon 3

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Jewish, African, Egyprtian, Cypriot
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Oron-Karni V, Filon D, Shifrin Y, Fried E, Pogrebijsky G, Oppenheim A, Rund D, Diversity of alpha-globin mutations and clinical presentation of alpha-thalassemia in Israel., American journal of hematology, 65(3), 196-203, 2000 PubMed
  2. Henderson SJ, Timbs AT, McCarthy J, Gallienne AE, Proven M, Rugless MJ, Lopez H, Eglinton J, Dziedzic D, Beardsall M, Khalil MS, Old JM, Ten Years of Routine α- and β-Globin Gene Sequencing in UK Hemoglobinopathy Referrals Reveals 60 Novel Mutations., Hemoglobin , 40(2), 75-84, 2016 PubMed

Microattributions

A/AContributor(s)DateComments
1Petrou, Miranda2022-10-03Report of an update.
Created on 2010-06-16 16:13:15, Last reviewed on 2022-10-04 09:52:54 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.