IthaID: 3990



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: -89 to -88 (-AC) HGVS Name: HBB:c.-139_-138delAC
Hb Name: N/A Protein Info: N/A
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
ACTTAGACCTCACCCTGTGGAGCCAC [AC/-] CCTAGGGTTGGCCAATCTACTCCCA (Strand: +)

Comments: Identified in a heterozygous state by NGS and validated by Sanger sequencing. No other mutations were found in the HBB, HBA1 and HBA2 genes by NGS and PCR analyses. The 2-bp deletion is found in the HBB region from -92 to -88 nt, which overlaps the proximal CACCC box. The β-globin gene promoter relies on the proximal CACCC box for correct regulation. The phastCons and PhyloP, which are two in silico tools for identifying evolutionarily conserved elements, showed that the sequences between -93 and -86 (CCACACCC) are highly conserved with a core sequence CACCC. The proband had normal red blood cell (RBC) indices, only with a slightly decreased red blood corpuscular volume distribution width (RDW) determined by a hematology analyzer (XN-9000, Sysmex). Hemoglobin analysis was performed by capillary electrophoresis (Capillarys 2 FIEX PIERCING, Sebia). The proband had 93.1% HbA (lower than normal), 4.2% Hb A2 and 2.7% Hb F (higher than normal).

External Links

No available links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β++ (silent)
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70456
Size: 2 bp
Located at: β
Specific Location: Promoter

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Promoter (Transcription)
Ethnic Origin: Chinese
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Pan L, Tian P, Chen S, Zhang R, Novel Promoter Mutation (:C.-139_-138del) Associated with β-Thalassemia Trait Detected by Next-Generation Sequencing in Southern China., Hemoglobin, 2023 PubMed

Microattributions

A/AContributor(s)DateComments
1Pan, Lei2022-12-13First report.
Created on 2022-12-13 12:33:35, Last reviewed on 2023-03-08 12:12:42 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.