IthaID: 40



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CAP +41 to +44 (-AACA) HGVS Name: HBB:c.-10_-7delAACA
Hb Name: N/A Protein Info: β nts 40 - 43 deleted

Context nucleotide sequence:
CACAACTGTGTTCACTAGCAACCTCA [-/AACA] GACACCATGGTGCATCTGACTCCT (Strand: -)

Also known as: CAP +40 to +43 (-AAAC)

Comments: Found in a heterozygous state during molecular screening. In vitro experiments did not show functional effects of the genetic variant. Further investigation was suggested. Papers reported a 4 bp deletion -AAAC [HBB: c.-11_-8delAAAC], which does not follow the 3' prime rule of HGVS recommendations.

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β+
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70585
Size: 4 bp
Located at: β
Specific Location: 5'UTR

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: 5'UTR (Transcription)
Ethnic Origin: Chinese
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: No

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Huang SZ, Xu YH, Zeng FY, Wu DF, Ren ZR, Zeng YT, A novel beta-thalassaemia mutation: deletion of 4 bp (-AAAC) in the 5' transcriptional sequence., British journal of haematology, 78(1), 125-6, 1991 PubMed
  2. Francès V, Morlé F, Godet J, Functional analysis of the 4 bp deletion identified in the 5' untranslated region of one of the beta-globin genes from a Chinese beta-thalassaemic heterozygote., Br. J. Haematol. , 84(1), 163-5, 1993 PubMed
Created on 2010-06-16 16:13:14, Last reviewed on 2021-12-15 11:39:21 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.