IthaID: 4077



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: CD 37 CCC>CC- HGVS Name: HBA1:c.114del
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
CCGCAGGATGTTCCTGTCCTTCCC [C/-] ACCACCAAGACCTACTTCCCGCACT (Strand: +)

Also known as:

Comments: Detected in a heterozygous state in a pregnant female presenting with mild hypochromic anemia. Functional analysis revealed that this variation considerably reduced the expression of the HBA1 protein.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

No available links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: α-thalassaemia
Allele Phenotype:N/A
Associated Phenotypes: N/A

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 37810
Size: 1 bp
Located at: α1
Specific Location: Exon 2

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: N/A
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Zhang W, Han X, Deng J, Zhou R, Du X, Wu C, Li M, Two Novel α-Thalassemia Mutations CD 39 -C [Thr > Pro] and CD 109 ACC > CCC [Thr > Pro] Identified in Two Chinese Families: A Case Report., Hemoglobin, 47(4), 172-179, 2023 PubMed
Created on 2023-11-13 13:05:45, Last reviewed on 2023-11-13 13:19:33 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.