IthaID: 416



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 131 (+T) >175aa HGVS Name: HBA1:c.396dup
Hb Name: Hb Pak Num Po Protein Info: α1 131(+T); modified C-terminal sequence: (132)Cys-Glu-His-Arg-Ala-Asp-Leu-Gln- Ile-Pro-Leu-Ser-Trp-Ser-Leu-Gly-Gly-His- Ala-Ser-Cys-Pro-Leu-Gly-Leu-Pro-Pro-Ala- Pro-Pro-Pro-Leu-Pro-Ala-Pro-Val-Pro-Pro- Trp-Ser-Leu-Asn-Lys-(175)Val-COOH
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
CTCCCTGGACAAGTTCCTGGCTTCT [-/T] GTGAGCACCGTGCTGACCTCCAAAT (Strand: +)

Comments: Found in compound heterozygosity with the –SEA deletion [IthaID:309] leading to Hb H disease. Also, patient with Hb Pak Num Po and the deletional mutation -α4.2 [IthaID:301] presented with mild hypochromic microcytic anemia and required no blood transfusions.

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia and Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: α-thalassaemia, α-chain variant
Allele Phenotype:α⁺
Stability: Hyperunstable
Oxygen Affinity: N/A
Associated Phenotypes: Haemolytic anaemia [HP:0001878]

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 38241
Size: 1 bp
Located at: α1
Specific Location: Exon 3

Other details

Type of Mutation: Point-Mutation(Insertion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Thai
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Viprakasit V, Tanphaichitr VS, Veerakul G, Chinchang W, Petrarat S, Pung-Amritt P, Higgs DR, Co-inheritance of Hb Pak Num Po, a novel alpha1 gene mutation, and alpha0 thalassemia associated with transfusion-dependent Hb H disease., American journal of hematology, 75(3), 157-63, 2004 PubMed
  2. Sanpakit K, Viprakasit V, Variable genotype-phenotype correlations in patients with a rare nondeletional α-thalassemia; Hb Pak Num Po (HBA1: c.396_397insT)., J Pediatr Hematol Oncol, 36(3), e185-9, 2014 PubMed
Created on 2010-06-16 16:13:15, Last reviewed on 2022-02-28 09:18:20 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.