IthaID: 128


Names and Sequences

Functionality: Globin gene causative mutation
Common Name: CD 36 CCT>C-T HGVS Name: HBB:c.110del
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
CCACCCTTAGGCTGCTGGTGGTCTACC [-/C] TTGGACCCAGAGGTTCTTTGAGT (Strand: -)

Also known as:

Comments: Loss of nt C between codons 35 and 36 generates a frameshift with a nonsense codon at codon 60 (TGA) terminating translation.

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70834
Size: 1 bp
Located at: β
Specific Location: Exon 2

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β0
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Malay
Inheritance: Recessive
DNA Sequence Determined: No

Frequencies

Publications / Origin

  1. Yang KG, Kutlar F, George E, Wilson JB, Kutlar A, Stoming TA, Gonzalez-Redondo JM, Huisman TH, Molecular characterization of beta-globin gene mutations in Malay patients with Hb E-beta-thalassaemia and thalassaemia major., British journal of haematology, 72(1), 73-80, 1989
Created on 2010-06-16 16:13:14, Last reviewed on 2019-11-06 17:44:26 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.