IthaID: 151

Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 44 -C HGVS Name: HBB:c.135delC
Hb Name: N/A Protein Info: β 44 (-C); modified C-terminal sequence: (44)Ser-Leu-Gly-Ile-Cys-Pro-Leu-Leu-Met-Leu- Leu-Trp-Ala-Thr-Leu-(59)Arg-COOH
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
CTTGGACCCAGAGGTTCTTTGAGTC [-/C] TTTGGGGATCTGTCCACTCCTGATG (Strand: -)

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β0
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70859
Size: 1 bp
Located at: β
Specific Location: Exon 2

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Kurdish
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: No

In silico pathogenicity prediction

Frequencies

Publications / Origin

  1. Kinniburgh AJ, Maquat LE, Schedl T, Rachmilewitz E, Ross J, mRNA-deficient beta o-thalassemia results from a single nucleotide deletion., Nucleic acids research, 10(18), 5421-7, 1982
  2. Rund D, Cohen T, Filon D, Dowling CE, Warren TC, Barak I, Rachmilewitz E, Kazazian HH, Oppenheim A, Evolution of a genetic disease in an ethnic isolate: beta-thalassemia in the Jews of Kurdistan., Proceedings of the National Academy of Sciences of the United States of America, 88(1), 310-4, 1991
Created on 2010-06-16 16:13:15, Last reviewed on 2014-05-12 09:26:13 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.