IthaID: 183


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 80/81 (-C) HGVS Name: HBB:c.244delC
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
GATGGCCTGGCTCACCTGGACAAC [-/C] TCAAGGGCACCTTTGCCACACTGA (Strand: -)

Also known as:

Comments: Loss of nt C between codons 80 and 81 generates a frameshift with a nonsense codon at codon 88 (TGA) terminating translation. Found in a heterozygous state.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β0
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70968
Size: 1 bp
Located at: β
Specific Location: Exon 2

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Iranian
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: No

In silico pathogenicity prediction

Publications / Origin

  1. Feleki X, Najmabadi H, Karimi-Nejad R, Christopoulos G, Kleanthous M, Identification of a novel beta0-thalassemia mutation, codons 80/81 (-C), in an Iranian family., Hemoglobin, 24(4), 319-21, 2000
Created on 2010-06-16 16:13:15, Last reviewed on 2019-11-07 09:47:56 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.