IthaID: 194

Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 91 (+T) HGVS Name: HBB:c.275dupT
Hb Name: N/A Protein Info: N/A
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
CACCTTTGCCACACTGAGTGAGCT [-/T] GCACTGTGACAAGCTGCACGTGGA (Strand: -)

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β0
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70999
Size: 1 bp
Located at: β
Specific Location: Exon 2

Other details

Type of Mutation: Point-Mutation(Insertion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Belgian
Molecular mechanism: Altered heme pocket
Inheritance: Recessive
DNA Sequence Determined: No

In silico pathogenicity prediction

Publications / Origin

  1. Chibani J, Vidaud M, Duquesnoy P, Bergé-Lefranc JL, Pirastu M, Ellouze F, Rosa J, Goossens M, The peculiar spectrum of beta-thalassemia genes in Tunisia., Human genetics, 78(2), 190-2, 1988
Created on 2010-06-16 16:13:15, Last reviewed on 2019-11-13 14:12:34 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.