IthaID: 199
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | IVS II-1 (-G) | HGVS Name: | HBB:c.315+1delG |
| Hb Name: | N/A | Protein Info: | N/A |
| Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
GCACGTGGATCCTGAGAACTTCAGG [G/-] TGAGTCTATGGGACGCTTGATGTTT (Strand: -)
Comments: Found in a heterozygous state with mild anaemia in a German Caucasian family of Huguenot descent. Presented with thalassaemia intermedia in a proband with alpha-globin triplication. Absence of aberrant or unstable haemoglobin (Hb) fraction in biochemical Hb analyses.
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia |
| Allele Phenotype: | β0 Dominant |
| Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 71040 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | Exon 2 |
Other details
| Type of Mutation: | Point-Mutation(Deletion) |
|---|---|
| Effect on Gene/Protein Function: | Splice junction (mRNA Processing) |
| Ethnic Origin: | German |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Lahr G, Brintrup J, Over S, Feurle GE, Debatin KM, Kohne E, Codon 104(-G), a dominant beta0-thalassemia-like phenotype in a German Caucasian family is associated with mild chronic hemolytic anemia but influenced in severity by co-inherited genetic factors., Haematologica , 92(9), 1264-5, 2007
Created on 2010-06-16 16:13:15,
Last reviewed on 2021-12-06 09:22:52 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.