IthaID: 2024

Names and Sequences

Functionality:	Globin gene causative mutation	Pathogenicity:	Pathogenic / Likely Pathogenic
Common Name:	CD 143 (-C)	HGVS Name:	HBB:c.430delC
Hb Name:	Hb Montreal II	Protein Info:	N/A
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
CTGGTGTGGCTAATGCCCTGGCC [C/-] ACAAGTATCACTAAGCTCGCTTTC (Strand: -)

Comments: Single nucleotide deletion (-C) at codon 143 resulting in a frameshift and the elongation of the β-globin chain, terminating translation at codon 157.

External Links

LOVD

Phenotype

Hemoglobinopathy Group:	Thalassaemia and Structural Haemoglobinopathy
Hemoglobinopathy Subgroup:	β-thalassaemia, β-chain variant
Allele Phenotype:	Thalassaemia dominant Dominant
Stability:	N/A
Oxygen Affinity:	N/A
Associated Phenotypes:	Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972]

IthaPhen

Heterozygous records (preview in IthaPhen)

Location

Chromosome:	11
Locus:	NG_000007.3
Locus Location:	72004
Size:	1 bp
Located at:	β
Specific Location:	Exon 3

Other details

Type of Mutation:	Point-Mutation(Deletion)
Effect on Gene/Protein Function:	Frameshift (Translation)
Ethnic Origin:	Canadian
Molecular mechanism:	N/A
Inheritance:	Dominant
DNA Sequence Determined:	Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

Chagnon P, Mollica L, Belisle C, Deveaux C, Angelo GD, Roy DC, Soulières D, Busque L., Hb Montreal II: a novel elongated beta-globin variant caused by a frameshift mutation [beta142 (-C)]., Hemoglobin, 32(4), 351-9, 2008 PubMed

Created on 2010-10-16 11:59:51, Last reviewed on 2023-08-04 12:57:56 (Show full history)

A/A	Date	Curator(s)	Comments
1	2010-10-16 11:59:51	The IthaGenes Curation Team	Created
2	2013-10-15 17:00:14	The IthaGenes Curation Team	Reviewed.
3	2019-11-07 10:18:01	The IthaGenes Curation Team	Reviewed. Common name, HGVS name and Location corrected. Allele and Context sequence added.
4	2019-11-07 10:19:42	The IthaGenes Curation Team	Reviewed. Protein info changed.
5	2023-08-04 12:57:56	The IthaGenes Curation Team	Reviewed. Common name corrected

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.