IthaID: 277



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: Poly A (-TA); (AATAAA>AAAA) HGVS Name: HBB:c.*110_*111delTA
Hb Name: N/A Protein Info: N/A
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
GGCCTTGAGCATCTGGATTCTGCCTAA [-/TA] AAAAACATTTATTTTCATTGCAAT (Strand: -)

Comments: Found in a French β-thalassaemic patient originating from Normandy. Found in an African American presenting with typical β-thal trait.

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β+
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 72128
Size: 2 bp
Located at: β
Specific Location: 3'UTR, Poly(A)

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: RNA cleavage - Poly(A) signal (mRNA Processing)
Ethnic Origin: French, African-American
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: No

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Frequencies

Publications / Origin

  1. Ghanem N, Girodon E, Vidaud M, Martin J, Fanen P, Plassa F, Goossens M, A comprehensive scanning method for rapid detection of beta-globin gene mutations and polymorphisms., Human mutation, 1(3), 229-39, 1992 PubMed
  2. Kimberland ML, Boehm CD, Kazazian HH, Two novel beta-thalassemia alleles: poly A signal (AATAAA-->AAAA) and -92 C-->T., Human mutation, 5(3), 275-6, 1995 PubMed
Created on 2010-06-16 16:13:15, Last reviewed on 2020-10-02 10:20:52 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.