IthaID: 278
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
---|---|---|---|
Common Name: | Poly A (-AATAA) | HGVS Name: | HBB:c.*110_*114del |
Hb Name: | N/A | Protein Info: | N/A |
Context nucleotide sequence:
GGGCCTTGAGCATCTGGATTCTGCCTAA [-/TAAAA] AACATTTATTTTCATTGCAATGATGT (Strand: -)
Also known as: polyA (-TAAAA)
Comments: A 5 bp deletion of the polyA signal sequence (AATAAA>A). Found in a homozygous state in an Arab child from Gaza and in a proband from Egypt, both with transfusion-dependent β-thalassaemia major. Found as a compound heterozygote with Hb S in a proband from Nigeria.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
Hemoglobinopathy Group: | Thalassaemia |
---|---|
Hemoglobinopathy Subgroup: | β-thalassaemia |
Allele Phenotype: | β+ |
Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 72128 |
Size: | 5 bp |
Located at: | β |
Specific Location: | 3'UTR, Poly(A) |
Other details
Type of Mutation: | Point-Mutation(Deletion) |
---|---|
Effect on Gene/Protein Function: | RNA cleavage - Poly(A) signal (mRNA Processing) |
Ethnic Origin: | Arab/Palestinian, Egyptian, Nigerian |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | No |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Frequencies
Publications / Origin
- Rund D, Dowling C, Najjar K, Rachmilewitz EA, Kazazian HH, Oppenheim A, Two mutations in the beta-globin polyadenylylation signal reveal extended transcripts and new RNA polyadenylylation sites., Proceedings of the National Academy of Sciences of the United States of America, 89(10), 4324-8, 1992 PubMed
- el-Kalla S, Mathews AR, A significant beta-thalassemia heterogeneity in the United Arab Emirates., Hemoglobin, 21(3), 237-47, 1997 PubMed
- Lacan P, Ponceau B, Aubry M, Francina A, Mild Hb S-beta(+)-thalassemia with a deletion of five nucleotides at the polyadenylation site of the beta-globin gene., Hemoglobin, 27(4), 257-9, 2003 PubMed
Created on 2010-06-16 16:13:15,
Last reviewed on 2020-10-02 10:21:09 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2010-06-16 16:13:15 | The IthaGenes Curation Team | Created |
2 | 2013-10-15 17:28:32 | The IthaGenes Curation Team | Reviewed. |
3 | 2014-06-04 12:14:21 | The IthaGenes Curation Team | Reviewed. Variation size corrected. HbVar link added. |
4 | 2019-11-06 17:04:24 | The IthaGenes Curation Team | Reviewed. Common name and Ethnicity corrected. HbVar link removed. Comment added. |
5 | 2019-11-06 17:06:57 | The IthaGenes Curation Team | Reviewed. dbSNP link added. |
6 | 2019-11-14 08:00:02 | The IthaGenes Curation Team | Reviewed. HGVS name and Location corrected. Comment added. |
7 | 2019-11-14 08:06:26 | The IthaGenes Curation Team | Reviewed. Synonyn name, Allele and Context sequence, Ethnic origin and Reference added. |
8 | 2020-10-02 10:21:09 | The IthaGenes Curation Team | Reviewed. Name edits |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-10-30 08:58:42