IthaID: 3345



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CAP +22 (G>T) HGVS Name: HBB:c.-29G>T
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
GCTTACATTTGCTTCTGACACAACT [T>G] TGTTCACTAGCAACCTCAAACAGAC (Strand: -)

Also known as:

Comments: Silent β-globin mutation found in a heterozygous state and in compound heterozygosity with the β0-thalassaemic allele HBB:c.92+1G>A [ithaID=101]. Following a pregnancy, the combination of the two alleles led to severe anemia with thansfusion-dependent β-thalassaemia intermedia phenotype.

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β++
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70566
Size: 1 bp
Located at: β
Specific Location: 5'UTR

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: 5'UTR (Transcription)
Ethnic Origin: Italian
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Vinciguerra M, Passarello C, Cassarà F, Leto F, Cannata M, Calvaruso G, Renda D, Maggio A, Giambona A, Coheredity of a new silent mutation: c.-29G>T, with a severe β-thal mutation in a patient with β-thalassemia intermediate., Int J Lab Hematol, 40(2), e17-e20, 2018 PubMed
Created on 2019-03-26 16:45:09, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.