IthaID: 3513
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | CD 8 AAG>AA- | HGVS Name: | HBB:c.27delG |
| Hb Name: | N/A | Protein Info: | N/A |
| Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
GGTGCATCTGACTCCTGAGGAGAA [G/-] TCTGCCGTTACTGCCCTGTGGGGCA (Strand: -)
Comments: Found as a de novo mutation in a compound heterozygous state with Hb E in a transfusion-dependent 1-year-old child presenting with β-thalassaemia major complications. The mother was a heterozygous carrier of Hb E and the father was evaluated as normal. Paternity was confirmed. The loss of a nt G from codon 8 changes the reading frame with a stop codon at codon 18 resulting in a premature termination of translation.
External Links
No available links
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia |
| Allele Phenotype: | β0 |
| Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 70621 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | Exon 1 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Missense codons (Protein Structure) |
| Ethnic Origin: | Bangladeshi |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Hasan KN, Sufian A, Mazumder AK, Khaleque MA, Rahman M, Akhteruzzaman S, A Novel Pathogenic β-Thalassemia Mutation Identified at Codon 8 (: c.27delG) in a Bangladeshi Family Acquired ., Hemoglobin, 43(3), 162-165, 2019 PubMed
Created on 2019-12-03 09:15:28,
Last reviewed on 2019-12-03 16:37:50 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.