IthaID: 3589



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: CD 62-65 (-12bp) HGVS Name: HBB:c.187_198delGCTCATGGCAAG
Hb Name: N/A Protein Info: p.62_65delAHGK

Context nucleotide sequence:
ACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAAG [-/GCTCATGGCAAG] AAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGCT (Strand: -)

Also known as:

Comments: Found in a heterozygote 3-years old boy with hemolytic anaemia since birth, elevated levels of HbF and HbA2 and target cells in the blood smear. The 12bp in frame deletion leading to a deletion of four amino acids. Patient also carries a mutation in PIEZO1 (c.5195C>T). Whether the clinical picture of the patient is caused by a strong modifying effect of the new mutation in PIEZO1 or is combined effect of two strongly deleterious mutations of PIEZO1 and β-globin gene is unclear.

External Links

No available links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:Unclear
Associated Phenotypes: Haemolytic anaemia [HP:0001878]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70911
Size: 12 bp
Located at: β
Specific Location: Exon 2

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Polish
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Maciak K, Adamowicz-Salach A, Siwicka A, Poznanski J, Urasinski T, Plochocka D, Gora M, Burzynska B, Hereditary xerocytosis - spectrum and clinical manifestations of variants in the PIEZO1 gene, including co-occurrence with a novel β-globin mutation., Blood Cells Mol. Dis., 80(0), 102378, 2020 PubMed
Created on 2020-05-18 14:23:17, Last reviewed on 2020-08-10 12:29:32 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.