IthaID: 3589
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | CD 62-65 (-12bp) | HGVS Name: | HBB:c.187_198delGCTCATGGCAAG |
Hb Name: | N/A | Protein Info: | p.62_65delAHGK |
Context nucleotide sequence:
ACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAAG [-/GCTCATGGCAAG] AAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGCT (Strand: -)
Also known as:
Comments: Found in a heterozygote 3-years old boy with hemolytic anaemia since birth, elevated levels of HbF and HbA2 and target cells in the blood smear. The 12bp in frame deletion leading to a deletion of four amino acids. Patient also carries a mutation in PIEZO1 (c.5195C>T). Whether the clinical picture of the patient is caused by a strong modifying effect of the new mutation in PIEZO1 or is combined effect of two strongly deleterious mutations of PIEZO1 and β-globin gene is unclear.
External Links
No available links
Phenotype
Hemoglobinopathy Group: | Thalassaemia |
---|---|
Hemoglobinopathy Subgroup: | β-thalassaemia |
Allele Phenotype: | Unclear |
Associated Phenotypes: | Haemolytic anaemia [HP:0001878] |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 70911 |
Size: | 12 bp |
Located at: | β |
Specific Location: | Exon 2 |
Other details
Type of Mutation: | Point-Mutation(Deletion) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | Polish |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Maciak K, Adamowicz-Salach A, Siwicka A, Poznanski J, Urasinski T, Plochocka D, Gora M, Burzynska B, Hereditary xerocytosis - spectrum and clinical manifestations of variants in the PIEZO1 gene, including co-occurrence with a novel β-globin mutation., Blood Cells Mol. Dis., 80(0), 102378, 2020 PubMed
Created on 2020-05-18 14:23:17,
Last reviewed on 2020-08-10 12:29:32 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2020-05-18 14:23:17 | The IthaGenes Curation Team | Created |
2 | 2020-05-20 11:26:34 | The IthaGenes Curation Team | Reviewed. Common name corrected. |
3 | 2020-05-22 11:24:18 | The IthaGenes Curation Team | Reviewed. Comment edit. |
4 | 2020-05-22 11:27:20 | The IthaGenes Curation Team | Reviewed. Publication added. |
5 | 2020-05-22 12:14:31 | The IthaGenes Curation Team | Reviewed. Publication added |
6 | 2020-06-11 18:56:01 | The IthaGenes Curation Team | Reviewed. Reference added. |
7 | 2020-06-11 18:58:33 | The IthaGenes Curation Team | Reviewed. Reference added. |
8 | 2020-06-11 18:59:00 | The IthaGenes Curation Team | Reviewed. Reference added. |
9 | 2020-06-11 19:00:14 | The IthaGenes Curation Team | Reviewed. Reference added. |
10 | 2020-06-11 19:00:58 | The IthaGenes Curation Team | Reviewed. Reference added. |
11 | 2020-06-11 19:01:28 | The IthaGenes Curation Team | Reviewed. Reference added. |
12 | 2020-07-15 11:04:34 | The IthaGenes Curation Team | Reviewed. Edits. |
13 | 2020-08-10 12:29:32 | The IthaGenes Curation Team | Reviewed. Reference added. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2023-03-21 11:16:02