IthaID: 3636
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | CD 104 (-A) | HGVS Name: | HBB:c.313delA |
Hb Name: | N/A | Protein Info: | N/A |
Context nucleotide sequence:
TGCACGTGGATCCTGAGAACTTC [A/-] GGGTGAGTCTATGGGACGCTTGA (Strand: -)
Also known as:
Comments: Found in a 12-year-old Chinese boy in compound heterozygosity with HBB:c.126_129delCTTT [IthaID:147] and the -α4.2 [IthaID:301]. Patient presented with severe β-thalassemia and required regular blood transfusions. The A deletion caused a frameshift at codon 104, which resulted in an elongated protein of 156 amino acid residues.
External Links
Phenotype
Hemoglobinopathy Group: | Thalassaemia |
---|---|
Hemoglobinopathy Subgroup: | β-thalassaemia |
Allele Phenotype: | β+ |
Associated Phenotypes: | N/A |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 71037 |
Size: | 1 bp |
Located at: | β |
Specific Location: | Exon 2 |
Other details
Type of Mutation: | Point-Mutation(Deletion) |
---|---|
Effect on Gene/Protein Function: | Frameshift (Translation) |
Ethnic Origin: | Chinese |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | Yes |
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Qiu Y, Huang Y, Chen P, Wei S, Su Q, Zhang Z, Yang Z, Ye L, Huang J, Shen X, Mo W, Compound Heterozygosity for a Novel Mutation Codon 104 (-A) (: c.313delA) and Codons 41/42 (-CTTT) (: c.126_129delCTTT) Leading to β-Thalassemia Major in a Chinese Family., Hemoglobin, 2020 PubMed
- Lin W, Zhang Q, Shen Z, Qu X, Wang Q, Wei L, Qiu Y, Yang J, Xu X, Lao J, Molecular and phenotype characterization of an elongated β-globin variant produced by HBB:C.313delA., Int J Lab Hematol, 43(6), 1620-1627, 2021 PubMed
Microattributions
A/A | Contributor(s) | Date | Comments |
---|---|---|---|
1 | Qiu, Yuling | 2020-09-07 | First report. |
Created on 2020-10-02 09:39:52,
Last reviewed on 2021-12-22 15:22:14 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2020-10-02 09:39:52 | The IthaGenes Curation Team | Created |
2 | 2020-10-02 09:48:16 | The IthaGenes Curation Team | Reviewed. Contributor added. |
3 | 2020-11-18 14:41:16 | The IthaGenes Curation Team | Reviewed. Reference added. |
4 | 2021-07-12 14:32:08 | The IthaGenes Curation Team | Reviewed. Comment corrected. |
5 | 2021-07-12 14:38:24 | The IthaGenes Curation Team | Reviewed. Allele phenotype added. |
6 | 2021-12-22 15:19:19 | The IthaGenes Curation Team | Reviewed. Reference added. |
7 | 2021-12-22 15:22:14 | The IthaGenes Curation Team | Reviewed. Link added. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2022-08-12 10:07:42