IthaID: 64



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 9/10 (+T) HGVS Name: HBB:c.30dupT
Hb Name: Hb Gaziantep Protein Info: N/A
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
GCATCTGACTCCTGAGGAGAAGTCT [-/T] GCCGTTACTGCCCTGTGGGGCAAGG (Strand: -)

Comments: Found in members of a Greek family, as a heterozygote in the father and in combination with a β+-thal mutation (HBB:c.93-21G>A) in his son. Found in combination with a β0-thal mutation (HBB:c.118C>T) in a Turkish patient presenting with a beta-thalassemia intermedia/major clinical picture.

Phenotype

Hemoglobinopathy Group: Thalassaemia and Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: β-thalassaemia, β-chain variant
Allele Phenotype:β0
Stability: Hyperunstable
Oxygen Affinity: N/A
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70624
Size: 1 bp
Located at: β
Specific Location: Exon 1

Other details

Type of Mutation: Point-Mutation(Insertion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Greek, Arab, Turkish
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: No

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Frequencies

Publications / Origin

  1. Waye JS, Eng B, Olivieri NF, Chui DH, Identification of a novel beta O-thalassaemia mutation in a Greek family and subsequent prenatal diagnosis., Prenatal diagnosis, 14(10), 929-32, 1994 PubMed
Created on 2010-06-16 16:13:14, Last reviewed on 2019-11-13 16:51:04 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.