IthaID: 140



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 38/39 (-C) HGVS Name: HBB:c.118delC
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
AGGCTGCTGGTGGTCTACCCTTGGACC [-/C] AGAGGTTCTTTGAGTCCTTTGGGG (Strand: -)

Also known as:

Comments: Loss of nt C between codons 38 and 39 generates a frameshift with a nonsense codon at codon 60 (TGA) terminating translation. Found in a heterozygous state and in compound heterozygosity with a nondeletional Gγ-HPFH in members of a Czechoslovakian family.

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β0
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70842
Size: 1 bp
Located at: β
Specific Location: Exon 2

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Czechoslovakian
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: No

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Frequencies

Publications / Origin

  1. Indrak K, Indrakova J, Kutlar F, Pospisilova D, Sulovska I, Baysal E, Huisman TH, Compound heterozygosity for a beta zero-thalassemia (frameshift codons 38/39; -C) and a nondeletional Swiss type of HPFH (A----C at NT -110, G gamma) in a Czechoslovakian family., Annals of hematology, 63(2), 111-5, 1991 PubMed
Created on 2010-06-16 16:13:15, Last reviewed on 2019-11-07 08:51:05 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.