IthaID: 140
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
---|---|---|---|
Common Name: | CD 38/39 (-C) | HGVS Name: | HBB:c.118delC |
Hb Name: | N/A | Protein Info: | N/A |
Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
AGGCTGCTGGTGGTCTACCCTTGGACC [C/-] AGAGGTTCTTTGAGTCCTTTGGGG (Strand: -)
Comments: Loss of nt C between codons 38 and 39 generates a frameshift with a nonsense codon at codon 60 (TGA) terminating translation. Found in a heterozygous state and in compound heterozygosity with a nondeletional Gγ-HPFH in members of a Czechoslovakian family. In a more recent study, the rare variant was identified in the Moroccan population in a homozygous state.
Phenotype
Hemoglobinopathy Group: | Thalassaemia |
---|---|
Hemoglobinopathy Subgroup: | β-thalassaemia |
Allele Phenotype: | β0 |
Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 70842 |
Size: | 1 bp |
Located at: | β |
Specific Location: | Exon 2 |
Other details
Type of Mutation: | Point-Mutation(Deletion) |
---|---|
Effect on Gene/Protein Function: | Frameshift (Translation) |
Ethnic Origin: | Czechoslovakian, Moroccan |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | No |
In silico pathogenicity prediction
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Frequencies
Publications / Origin
- Indrak K, Indrakova J, Kutlar F, Pospisilova D, Sulovska I, Baysal E, Huisman TH, Compound heterozygosity for a beta zero-thalassemia (frameshift codons 38/39; -C) and a nondeletional Swiss type of HPFH (A----C at NT -110, G gamma) in a Czechoslovakian family., Annals of hematology, 63(2), 111-5, 1991 PubMed
- Belmokhtar I, Lhousni S, Elidrissi Errahhali M, Ghanam A, Elidrissi Errahhali M, Sidqi Z, Ouarzane M, Charif M, Bellaoui M, Boulouiz R, Benajiba N, Molecular heterogeneity of β-thalassemia variants in the Eastern region of Morocco., Mol Genet Genomic Med, 10(8), e1970, 2022 PubMed
Created on 2010-06-16 16:13:15,
Last reviewed on 2025-03-17 12:41:46 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.