IthaID: 147
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
---|---|---|---|
Common Name: | CD 41/42 (-CTTT) | HGVS Name: | HBB:c.126_129delCTTT |
Hb Name: | N/A | Protein Info: | β 41 - 42 (-TTCT) or β 41 - 42 (-CTTT) or β 41 - 42 (-TCTT); modified C-terminal sequence |
Context nucleotide sequence:
TGGTCTACCCTTGGACCCAGAGGTT [-/CTTT] GAGTCCTTTGGGGATCTGTCCACTC (Strand: -)
Also known as: CD 41/42 (-TTCT), CD 41/42 (-TCTT)
Comments: Also reported in literature as CD 41/42 -TTCT or -TCTT, which do not follow the HGVS Sequence Variant Nomeclature recommendations.
Phenotype
Hemoglobinopathy Group: | Thalassaemia |
---|---|
Hemoglobinopathy Subgroup: | β-thalassaemia |
Allele Phenotype: | β0 |
Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 70850 |
Size: | 4 bp |
Located at: | β |
Specific Location: | Exon 2 |
Other details
Type of Mutation: | Point-Mutation(Deletion) |
---|---|
Effect on Gene/Protein Function: | Frameshift (Translation) |
Ethnic Origin: | Chinese, SE Asian, Indian, Thai |
Molecular mechanism: | Altered heme pocket |
Inheritance: | Recessive |
DNA Sequence Determined: | No |
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Frequencies
Publications / Origin
- Kimura A, Matsunaga E, Takihara Y, Nakamura T, Takagi Y, Lin S, Lee H, Structural analysis of a beta-thalassemia gene found in Taiwan., The Journal of biological chemistry, 258(5), 2748-9, 1983 PubMed
- Kazazian HH, Orkin SH, Antonarakis SE, Sexton JP, Boehm CD, Goff SC, Waber PG, Molecular characterization of seven beta-thalassemia mutations in Asian Indians., The EMBO journal, 3(3), 593-6, 1984 PubMed
- Panyasai S, Satthakarn S, Pornprasert S, Complex Interaction of Hb Q-Thailand (HBA1: c.223G>C) with β-Thalassemia/Hb E (HBB: c.79G>A) Disease., Hemoglobin, 42(1), 54-57, 2018 PubMed
Created on 2010-06-16 16:13:15,
Last reviewed on 2021-12-15 11:47:43 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2010-06-16 16:13:15 | The IthaGenes Curation Team | Created |
2 | 2013-10-15 17:28:32 | The IthaGenes Curation Team | Reviewed. |
3 | 2014-04-11 09:53:09 | The IthaGenes Curation Team | Reviewed. Corrected mutation size |
4 | 2014-04-24 16:05:19 | The IthaGenes Curation Team | Reviewed. Added ClinVar link. |
5 | 2015-01-19 15:17:00 | The IthaGenes Curation Team | Reviewed. Common name and HGVS name updated. |
6 | 2015-01-19 15:18:17 | The IthaGenes Curation Team | Reviewed. Protein name updated. |
7 | 2019-09-27 12:55:17 | The IthaGenes Curation Team | Reviewed. Reference, Origin and DNA info added. |
8 | 2019-11-04 13:59:20 | The IthaGenes Curation Team | Reviewed. Protein name added. |
9 | 2019-11-21 17:04:51 | The IthaGenes Curation Team | Reviewed. Common/HGVS names and Location corrected. Comment added. |
10 | 2021-12-15 11:47:43 | The IthaGenes Curation Team | Reviewed. Other names added. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2022-06-30 11:49:51