IthaID: 147



Names and Sequences

Functionality: Globin gene causative mutation
Common Name: CD 41/42 (-TTCT or -CTTT or -TCTT) HGVS Name: HBB:c.124_127delTTCT | HBB:c.126_129delCTTT | HBB:c.125_128delTCTT
Hb Name: N/A Protein Info: β 41 - 42 (-TTCT) or β 41 - 42 (-CTTT); modified C-terminal sequence

Context nucleotide sequence:
TGGTCTACCCTTGGACCCAGAGGTT [-/CTTT] GAGTCCTTTGGGGATCTGTCCACTC (Strand: -)

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70848 or 70849 or 70850
Size: 4 bp or 1 bp or 4 bp
Located at: β
Specific Location: Exon 2

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β0
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Chinese, SE Asian, Indian, Thai
Inheritance: Recessive
DNA Sequence Determined: No
Detection Methods: MLPA

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Frequencies

Publications / Origin

  1. Kimura A, Matsunaga E, Takihara Y, Nakamura T, Takagi Y, Lin S, Lee H, Structural analysis of a beta-thalassemia gene found in Taiwan., The Journal of biological chemistry, 258(5), 2748-9, 1983 PubMed
  2. Kazazian HH, Orkin SH, Antonarakis SE, Sexton JP, Boehm CD, Goff SC, Waber PG, Molecular characterization of seven beta-thalassemia mutations in Asian Indians., The EMBO journal, 3(3), 593-6, 1984 PubMed
  3. Panyasai S, Satthakarn S, Pornprasert S, Complex Interaction of Hb Q-Thailand (HBA1: c.223G>C) with β-Thalassemia/Hb E (HBB: c.79G>A) Disease., Hemoglobin, 42(1), 54-57, 2018 PubMed
Created on 2010-06-16 16:13:15, Last reviewed on 2019-09-27 12:55:17 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.

Please publish modules in offcanvas position.