IthaID: 196
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | CD 95 (+A) | HGVS Name: | HBB:c.287dupA |
| Hb Name: | N/A | Protein Info: | β 95(+A); modified C-terminal sequence: (95)Lys-Ala-Ala-Arg-Gly-Ser-(101)COOH |
Context nucleotide sequence:
CACTGAGTGAGCTGCACTGTGACAA [-/A] GCTGCACGTGGATCCTGAGAACTTC (Strand: -)
Also known as:
Comments: Found in one Thai beta-thalassemia/HbE patient [PMID: 1515453]. Found in two Vietnamese families. Found in a heterozygous state in the mother and in combination with a β0 allele (codon 17 nonsense) in her four children in the first family. Found in a heterozygous state in the father and in combination with Hb E in one child in the second family. The introduction of a nt A in codon 95 (AAG>AAAG), or between codons 94 (GAC) and 95 (AAG), changes the reading frame with termination of translation at codon 101 (TGA).
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia |
| Allele Phenotype: | β0 |
| Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 71011 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | Exon 2 |
Other details
| Type of Mutation: | Point-Mutation(Insertion) |
|---|---|
| Effect on Gene/Protein Function: | Frameshift (Translation) |
| Ethnic Origin: | Thai | Vietnamese |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | No |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Winichagoon P, Fucharoen S, Wilairat P, Chihara K, Fukumaki Y, Wasi P, Identification of five rare mutations including a novel frameshift mutation causing beta zero-thalassemia in Thai patients with beta zero-thalassemia/hemoglobin E disease., Biochimica et biophysica acta, 1139(4), 280-6, 1992 PubMed
- Cai S, Chehab FF, New frameshift mutation, insertion of A, at codon 95 of the beta-globin gene causes beta-thalassemia in two Vietnamese families., Human mutation, 8(3), 293-4, 1996 PubMed
Created on 2010-06-16 16:13:15,
Last reviewed on 2019-11-12 10:38:25 (Show full history)
| A/A | Date | Curator(s) | Comments |
|---|---|---|---|
| 1 | 2010-06-16 16:13:15 | The IthaGenes Curation Team | Created |
| 2 | 2013-10-15 17:28:32 | The IthaGenes Curation Team | Reviewed. |
| 3 | 2014-04-24 16:50:38 | The IthaGenes Curation Team | Reviewed. Added ClinVar link. |
| 4 | 2019-11-12 10:37:30 | The IthaGenes Curation Team | Reviewed. HGVS name corrected. Comment added. |
| 5 | 2019-11-12 10:38:25 | The IthaGenes Curation Team | Reviewed. Origin corrected. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2023-03-22 16:46:31