IthaID: 196



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 95 (+A) HGVS Name: HBB:c.287dupA
Hb Name: N/A Protein Info: β 95(+A); modified C-terminal sequence: (95)Lys-Ala-Ala-Arg-Gly-Ser-(101)COOH

Context nucleotide sequence:
CACTGAGTGAGCTGCACTGTGACAA [-/A] GCTGCACGTGGATCCTGAGAACTTC (Strand: -)

Also known as:

Comments: Found in one Thai beta-thalassemia/HbE patient [PMID: 1515453]. Found in two Vietnamese families. Found in a heterozygous state in the mother and in combination with a β0 allele (codon 17 nonsense) in her four children in the first family. Found in a heterozygous state in the father and in combination with Hb E in one child in the second family. The introduction of a nt A in codon 95 (AAG>AAAG), or between codons 94 (GAC) and 95 (AAG), changes the reading frame with termination of translation at codon 101 (TGA).

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β0
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 71011
Size: 1 bp
Located at: β
Specific Location: Exon 2

Other details

Type of Mutation: Point-Mutation(Insertion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Thai | Vietnamese
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: No

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Winichagoon P, Fucharoen S, Wilairat P, Chihara K, Fukumaki Y, Wasi P, Identification of five rare mutations including a novel frameshift mutation causing beta zero-thalassemia in Thai patients with beta zero-thalassemia/hemoglobin E disease., Biochimica et biophysica acta, 1139(4), 280-6, 1992 PubMed
  2. Cai S, Chehab FF, New frameshift mutation, insertion of A, at codon 95 of the beta-globin gene causes beta-thalassemia in two Vietnamese families., Human mutation, 8(3), 293-4, 1996 PubMed
Created on 2010-06-16 16:13:15, Last reviewed on 2019-11-12 10:38:25 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.