IthaID: 199



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: IVS II-1 (-G) HGVS Name: HBB:c.315+1delG
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
GCACGTGGATCCTGAGAACTTCAGG [G/-] TGAGTCTATGGGACGCTTGATGTTT (Strand: -)

Also known as:

Comments: Found in a heterozygous state with mild anaemia in a German Caucasian family of Huguenot descent. Presented with thalassaemia intermedia in a proband with alpha-globin triplication. Absence of aberrant or unstable haemoglobin (Hb) fraction in biochemical Hb analyses.

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β0
Dominant
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 71040
Size: 1 bp
Located at: β
Specific Location: Exon 2

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Splice junction (mRNA Processing)
Ethnic Origin: German
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Lahr G, Brintrup J, Over S, Feurle GE, Debatin KM, Kohne E, Codon 104(-G), a dominant beta0-thalassemia-like phenotype in a German Caucasian family is associated with mild chronic hemolytic anemia but influenced in severity by co-inherited genetic factors., Haematologica , 92(9), 1264-5, 2007 PubMed
Created on 2010-06-16 16:13:15, Last reviewed on 2021-12-06 09:22:52 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.