IthaID: 2553



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 14 CTG>C-G HGVS Name: HBB:c.44delT
Hb Name: N/A Protein Info: β 14(A11) Leu>Arg-Gly-Ala-Arg-stop

Context nucleotide sequence:
GAGGAGAAGTCTGCCGTTACTGCCC [T/-] GTGGGGCAAGGTGAACGTGGATGAA (Strand: -)

Also known as:

Comments: The deletion determines a frameshift and the generation of a premature termination codon (codon 18).

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β0
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70638
Size: 1 bp
Located at: β
Specific Location: Exon 1

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Argentinean, Spanish
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Pepe C, Eberle SE, Chaves A, Milanesio B, Aguirre FM, Gómez VA, Diaz L, Mansini AP, Fernandez DA, Sciuccati G, Candas A, Cervio C, Bonduel M, Feliú-Torres A, A new β(0) frameshift mutation, HBB: c.44delT (p.Leu14ArgfsX5), identified in an Argentinean family associated with secondary genetic modifiers of β-thalassemia., Hemoglobin , 38(6), 444-6, 2014 PubMed
Created on 2015-06-16 13:19:21, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.