IthaID: 3561



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 2 CAT/CA- HGVS Name: HBB:c.9delT
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
ACCTCAAACAGACACCATGGTGCA [-/T] CTGACTCCTGAGGAGAAGTCTGCCG (Strand: -)

Also known as:

Comments: The loss of a nt T from codon 2 creates a shift in the reading frame with a premature stop codon at codon 3 (TGA). Found together with the promoter mutation HBB:c.-248A>G in one individual (MCV: 51.9 fL, MCH: 15.5 pg, Hb: 10 g/dL, HbA2: 5.7%).

External Links

No available links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β0
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70603
Size: 1 bp
Located at: β
Specific Location: Exon 1

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Azerbaijani
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Bayramov B, Aliyeva G, Asadov C, Mammadova T, Karimova N, Eynullazadeh K, Gafarova S, Akbarov S, Farhadova S, Safarzadeh Z, Abbasov M, A Novel Frameshift Mutation at Codon 2 (-T) (: c.9delT) and First Report of Three New β-Globin Mutations From Azerbaijan., Hemoglobin, 43(0), 280-282, 2019 PubMed
Created on 2020-01-30 11:04:24, Last reviewed on 2020-01-30 16:13:19 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.