IthaID: 51



Names and Sequences

Functionality: Globin gene causative mutation
Common Name: CD 2-4 (-9 bp, +31 bp) HGVS Name: HBB:c.8_16delinsCTGAGGTGAAGTCTGCCTGAGGAGAAGT
Hb Name: N/A Protein Info: β 2(NA2) - 4(A1) His-Leu-Thr->0 AND beta 2(+CCTGAGGTGAAGTCTGCCTGAGGAGAAGTCT); modified C-terminal sequence: (2)Pro-Glu-Val-Lys-Ser-(7)Ala-COOH

Context nucleotide sequence:
CAACCTCAAACAGACACCATGGTGC [ATCTGA/CTGAGGTGAAGTCTGCCTGAGGAGAAGT] CTCCTGAGGAGAAGTCTGCCGTTAC (Strand: -)

Also known as:

Comments: Found as a compound heterozygote with Hb S in twins of an Algerian family living in Southern France.

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70602
Size: 6 bp
Located at: β
Specific Location: Exon 1

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β0
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Algerian
Inheritance: Recessive
DNA Sequence Determined: No

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Badens C, Thuret I, Michel G, Krawczak M, Mattei JF, Lena-Russo D, Labie D, Elion J, Novel and unusual deletion-insertion thalassemic mutation in exon 1 of the beta-globin gene., Human mutation, 8(1), 89-92, 1996 PubMed
Created on 2010-06-16 16:13:14, Last reviewed on 2019-11-07 12:57:47 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.